Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1 shPIK3CD.v1 puro
(Plasmid #58706)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58706 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Weinberg Lab (Addgene plasmid 8453)
  • Total vector size (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shPIK3CD
  • gRNA/shRNA sequence
    CCGGCGCCAAGATGTGCCAATTCTGCTGCAGCAGAATTGGCACATCTTGGCGTTTTTG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_005026
  • Entrez Gene
    PIK3CD (a.k.a. APDS, IMD14, IMD14A, IMD14B, P110DELTA, PI3K, ROCHIS, p110D)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The primers were generated by the TRC (#TRCN0000199099) Construct mildly knocks down p110d (PIK3CD) protein expression ~5 fold after 3 X 500 uL infection in MCF10A-5E cells.

The specificity of this construct has not been confirmed by addback, but a second hairpin against the same target yielded the same phenotype.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 shPIK3CD.v1 puro was a gift from Kevin Janes (Addgene plasmid # 58706 ; http://n2t.net/addgene:58706 ; RRID:Addgene_58706)
  • For your References section:

    Parameterizing cell-to-cell regulatory heterogeneities via stochastic transcriptional profiles. Bajikar SS, Fuchs C, Roller A, Theis FJ, Janes KA. Proc Natl Acad Sci U S A. 2014 Feb 4;111(5):E626-35. doi: 10.1073/pnas.1311647111. Epub 2014 Jan 21. 10.1073/pnas.1311647111 PubMed 24449900