Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL2 HNF4A P2 mut
(Plasmid #60325)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 60325 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5598
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    HNF4A P2 mut (-181 G to A)
  • Species
    H. sapiens (human)
  • Mutation
    The -181 G to A mutation is in a HNF1alpha binding site and cosegregates with MODY.
  • Entrez Gene
    HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF14)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (not destroyed)
  • 3′ cloning site Unknown (not destroyed)
  • 5′ sequencing primer GLprimer2 (Promega): CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

–371 to –37 from HNF4A TSS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL2 HNF4A P2 mut was a gift from Jorge Ferrer (Addgene plasmid # 60325 ; ; RRID:Addgene_60325)
  • For your References section:

    Genetic evidence that HNF-1alpha-dependent transcriptional control of HNF-4alpha is essential for human pancreatic beta cell function. Hansen SK, Parrizas M, Jensen ML, Pruhova S, Ek J, Boj SF, Johansen A, Maestro MA, Rivera F, Eiberg H, Andel M, Lebl J, Pedersen O, Ferrer J, Hansen T. J Clin Invest. 2002 Sep;110(6):827-33. 10.1172/JCI15085 PubMed 12235114