Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #60446)


Item Catalog # Description Quantity Price (USD)
Plasmid 60446 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7000
  • Modifications to backbone
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (e.g. Invitrogen's Stbl3)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    changed Threonine 391 to Ananine
  • Promoter CAG

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    AAV-FLEX-FLIM-AKART391A is a point mutant of AAV-FLEX-FLIM-AKAR from our laboratory. FLIM-AKAR was modified from AKAR3 from Jin Zhang's laboratory at Johns Hopkins University.
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-FLIM-AKART391A was a gift from Bernardo Sabatini (Addgene plasmid # 60446 ; ; RRID:Addgene_60446)
  • For your References section:

    A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging. Chen Y, Saulnier JL, Yellen G, Sabatini BL. Front Pharmacol. 2014 Apr 2;5:56. doi: 10.3389/fphar.2014.00056. eCollection 2014. 10.3389/fphar.2014.00056 PubMed 24765076