AAV-FLEX-FLIM-AKART391A
(Plasmid
#60446)
-
PurposeExpresses the non-phosphorylatable point mutant (T391A) of FLIM-AKAR in a Cre dependent manner in an AAV backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 60446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV-FLEX
-
Backbone manufacturerScott Sternson
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 7000
-
Modifications to backboneN/A
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli (e.g. Invitrogen's Stbl3)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFLIM-AKART391A
-
SpeciesSynthetic
-
Insert Size (bp)1900
-
Mutationchanged Threonine 391 to Ananine
- Promoter CAG
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer GAGGTTGATTATCGATAAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAAV-FLEX-FLIM-AKART391A is a point mutant of AAV-FLEX-FLIM-AKAR from our laboratory. FLIM-AKAR was modified from AKAR3 from Jin Zhang's laboratory at Johns Hopkins University.
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-FLEX-FLIM-AKART391A was a gift from Bernardo Sabatini (Addgene plasmid # 60446 ; http://n2t.net/addgene:60446 ; RRID:Addgene_60446) -
For your References section:
A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging. Chen Y, Saulnier JL, Yellen G, Sabatini BL. Front Pharmacol. 2014 Apr 2;5:56. doi: 10.3389/fphar.2014.00056. eCollection 2014. 10.3389/fphar.2014.00056 PubMed 24765076