Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #60445)


Item Catalog # Description Quantity Price (USD)
Plasmid 60445 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7000
  • Modifications to backbone
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (e.g. Invitrogen's Stbl3)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    FLIM-AKAR was modified from AKAR3 from Jin Zhang's laboratory at Johns Hopkins University.
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-FLEX-FLIM-AKAR was a gift from Bernardo Sabatini (Addgene plasmid # 60445 ; ; RRID:Addgene_60445)
  • For your References section:

    A PKA activity sensor for quantitative analysis of endogenous GPCR signaling via 2-photon FRET-FLIM imaging. Chen Y, Saulnier JL, Yellen G, Sabatini BL. Front Pharmacol. 2014 Apr 2;5:56. doi: 10.3389/fphar.2014.00056. eCollection 2014. 10.3389/fphar.2014.00056 PubMed 24765076