AAV-FLEX-PKIalpha-IRES-nls-mRuby2
(Plasmid #63059)

• Purpose: Expresses PKIalpha and nuclear localized mRuby2 (linked with IRES) in a Cre-dependent manner in an AAV backbone
• Depositing Lab: Bernardo Sabatini
• Publication: Chen et al Front Pharmacol. 2014 Apr 2;5:56. doi: 10.3389/fphar.2014.00056. eCollection 2014.

Backbone

• Vector backbone: AAV-FLEX-tmeGFP-IRES-nls-mRuby2
• Backbone manufacturer: Yao Chen and Bernardo Sabatini
• Backbone size w/o insert (bp): 6400
• Total vector size (bp): 6641
• Modifications to backbone: N/A
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli (e.g. Invitrogen's Stbl3)
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PKIalpha
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 231
• GenBank ID: NM_008862
• Entrez Gene: Pkia (a.k.a. AI415001, PKIalpha)
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: GAGGTTGATTATCGATAAGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry