eGFPbait-E2A-KalTA4-pA donor vector
(Plasmid #61069)

• Purpose: for CRISPR/Cas9 mediated insertion of E2A-KalTA4; to be used in combination with a eGFP specific sgRNA (e.g. Plasmid 61051)
• Depositing Lab: Filippo Del Bene
• Publication: Auer et al Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31.

Backbone

• Vector backbone: pCRII-TOPO
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 5759
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: eGFPbait
• Species: Synthetic
• Insert Size (bp): 236

Cloning Information for Gene/Insert 1

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13-Rev

Gene/Insert 2

• Gene/Insert name: KalTA4
• Alt name: optimized Gal4-activator
• Species: Synthetic
• Insert Size (bp): 1497
• Tag / Fusion Protein:
  • E2A (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: n/a
• 3′ sequencing primer: M13-F

Resource Information

• Supplemental Documents:
  • eGFPbait-E2A-KalTA4-pA genbank file
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI.