pCM433kanT
(Plasmid #61262)

• Purpose: (Empty Backbone) Sucrose counterselection (sacB) vector for unmarked allelic exchange.
• Depositing Lab: Mary Lidstrom
• Publication: Puri et al Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14.

Backbone

• Vector backbone: pCM433
• Backbone size (bp): 5367
• Modifications to backbone: Removed cat, tet, and bla antibiotic resistance markers and added kan marker.
• Vector type: Bacterial Expression, Synthetic Biology ; Sucrose counterselection

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning

Resource Information

• Supplemental Documents:
  • pCM433kanT.gb
• A portion of this plasmid was derived from a plasmid made by: pCM433 received from Christopher Marx.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

In order to use plasmid pCM433kanT, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'):

AP186_pCM433kanT_fwd1 - ATGTGCAGGTTGTCGGTGTC
AP187_pCM433kanT_rev1 - TGGTAACTGTCAGACCAAGTTTACTC