This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

px335 Mettl14 sgRNA #1
(Plasmid #61515)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 61515 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbs1 (destroyed during cloning)
  • 3′ cloning site Bbs1 (destroyed during cloning)
  • 5′ sequencing primer TGGCCTTTTGCTCACATGTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px335 Mettl14 sgRNA #1 was a gift from Jacob Hanna (Addgene plasmid # 61515 ; ; RRID:Addgene_61515)
  • For your References section:

    m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Shay Geula, Sharon Moshitch-Moshkovitz, Dan Dominissini, Abed AlFatah Mansour, Nitzan Kol, Mali Salmon-Divon, Vera Hershkovitz, Eyal Peer, Nofar Mor, Yair S. Manor, Moshe Shay Ben-Haim, Eran Eyal, Sharon Yunger, Yishay Pinto, Diego Adhemar Jaitin, Sergey Viukov, Yoach Rais, Vladislav Krupalnik, Elad Chomsky, Mirie Zerbib, Itay Maza, Yoav Rechavi, Rada Massarwa, Suhair Hanna, Ido Amit, Erez Y. Levanon, Ninette Amariglio, Noam Stern-Ginossar, Noa Novershtern, Gideon Rechavi and Jacob H. Hanna . Science 1 January 2015 10.1126/science.1261417