Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pRS316 GAL cluster
(Plasmid #61925)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61925 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS316
  • Total vector size (bp) 10066
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    GAL1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1587
  • Entrez Gene
    GAL1 (a.k.a. YBR020W)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    GAL10
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2100
  • GenBank ID
    NM_001178367.1
  • Entrez Gene
    GAL10 (a.k.a. YBR019C)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer Gal10pro-F (GGTGGTAATGCCATGTAATATG)
  • 3′ sequencing primer M13-R
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS316 GAL cluster was a gift from Jon Houseley (Addgene plasmid # 61925 ; http://n2t.net/addgene:61925 ; RRID:Addgene_61925)
  • For your References section:

    Endogenous RNA interference is driven by copy number. Cruz C, Houseley J. Elife. 2014 Feb 11;3:e01581. doi: 10.7554/eLife.01581. 10.7554/eLife.01581 PubMed 24520161