-
PurposeExpresses Fok1:dCas9 under control of nanos promoter and 3'UTR. For germ line restricted high specificity genome engineering in Drosophila melanogaster.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62210 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepnos
-
Backbone manufacturerJohannes Bischof and Konrad Basler
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 13981
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFok1-dCas9
-
Insert Size (bp)4770
- Promoter nanos
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTATCGCGAATACTTCAGTTG
- 3′ sequencing primer CTGGTTAACCCAGCTTTGATCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit crisprflydesign.org for more information.
Please acknowledge Fillip Port and Simon Bullock when publishing work derived from the use of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pnos-Fok1:dCas9-nos was a gift from Simon Bullock (Addgene plasmid # 62210 ; http://n2t.net/addgene:62210 ; RRID:Addgene_62210)