-
PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMP177_U6 (derived from pSico)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersMarked by mCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namesgRNA + 1x COM binding module
-
MutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATA
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gagatccagtttggttagtaccggg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCOM-VP64
-
Alt nameCOM RNA binding protein fused to VP64
- Promoter CMV
-
Tag
/ Fusion Protein
- VP64 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer N/A
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJZC48 was a gift from Wendell Lim & Stanley Qi (Addgene plasmid # 62336 ; http://n2t.net/addgene:62336 ; RRID:Addgene_62336) -
For your References section:
Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Zalatan JG, Lee ME, Almeida R, Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. 10.1016/j.cell.2014.11.052 PubMed 25533786