pTrex-b-NLS-hSpCas9
(Plasmid #62543)

• Purpose: Expression of Cas9 in T. cruzi
• Depositing Lab: Rick Tarleton
• Publication: Peng et al MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14.

Backbone

• Vector backbone: pTrex-b
• Backbone manufacturer: doi:10.1016/S0378-1119(99)00386-8
• Backbone size w/o insert (bp): 5791
• Total vector size (bp): 10063
• Modifications to backbone: None
• Vector type: CRISPR ; Trypanosoma cruzi expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-hSpCas9
• Insert Size (bp): 4272
• Promoter: Ribo-HX1
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTTTCACGCACGAAAGCGAA
• 3′ sequencing primer: CTCCTTCGGCAGGTTGTTCT

Resource Information

• Supplemental Documents:
  • GenBank annotation file
• A portion of this plasmid was derived from a plasmid made by: NLS-hSpCas9 insert was subcloned from pX330 from Addgene deposited by Dr Feng Zhang's lab
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry