pTrex-Neo-tdTomato
(Plasmid
#47975)
-
PurposeTrasgenically expresses tandem tdtomato fluorescent protein in T. cruzi
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTrex-Neo
-
Backbone manufacturerMartin P. Vazquez
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 7700
-
Vector typeTrypanasoma cruzi expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
Alt nametandem dimer tomato fluorescent protein
-
SpeciesSynthetic; Discosoma sp
-
Insert Size (bp)1463
- Promoter T. cruzi rRNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CGCACGAAAGCGAAATTATTATG
- 3′ sequencing primer GCAAAAAGGGAAGTGAGCAAAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byShaner NC
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572
Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrex-Neo-tdTomato was a gift from Rick Tarleton (Addgene plasmid # 47975 ; http://n2t.net/addgene:47975 ; RRID:Addgene_47975) -
For your References section:
In vitro and in vivo high-throughput assays for the testing of anti-Trypanosoma cruzi compounds. Canavaci AM, Bustamante JM, Padilla AM, Perez Brandan CM, Simpson LJ, Xu D, Boehlke CL, Tarleton RL. PLoS Negl Trop Dis. 2010 Jul 13;4(7):e740. doi: 10.1371/journal.pntd.0000740. 10.1371/journal.pntd.0000740 PubMed 20644616