Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lentiCas9n(D10A)-Blast
(Plasmid #63593)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 63593 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 63593-LV Virus (1 mL at titer > 5x10⁵ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW
  • Total vector size (bp) 12860
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    S. pyogenes CRISPR-Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4200
  • Mutation
    D10A, nickase mutant
  • Promoter EFS-NS
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI, XbaI, AfeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pLLU-F
  • 3′ sequencing primer blast-R
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Blasticidin resistance
  • Alt name
    blasticidin S deaminase
  • Alt name
    bsd
  • Insert Size (bp)
    399
  • Promoter EFS-NS

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer needs custom
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Special note from the Zhang lab: We are constantly improving our CRISPR reagents. Please check www.genome-engineering.org for the most up-to-date information.

Information for Lentiviral Prep (Catalog # 63593-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from lentiCas9n(D10A)-Blast (#63593). In addition to the viral particles, you will also receive purified lentiCas9n(D10A)-Blast plasmid DNA.

Delivery

  • Volume 1 mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Blasticidin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 63593-LV and treated with blasticidin. Blasticidin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet. and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out on the viral preparation with primers targeting Cas9 and the blasticidin-resistance gene. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: SpCas9-F2 GATGAAGAACTACTGGCGGC
    Reverse Primer: Blast-R GCTCTTTCAATGAGGGTGGA
  • Confirmation of protein expression: A549 cells were transduced with serial dilutions of 63593-LV and treated with blasticidin. Polyclonal pools of blasticidin-resistant cells were expanded, collected, lysed and tested for Cas9 expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Addgene Comments

While the typical yield for lentiviral vectors ranges from 10⁶-10⁷ TU/mL, titers for large or toxic inserts, such as for Cas9, can be 10-fold to 100-fold lower. Scientists generating their own lentiviral particles from Cas9 should expect similarly low titers.

To demonstrate that Addgene’s virus is fully functional, Addgene has generated stable cell lines from the Cas9-expressing lentiviruses. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCas9n(D10A)-Blast was a gift from Feng Zhang (Addgene plasmid # 63593)
  • For your References section:

    Improved vectors and genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. 10.1038/nmeth.3047 PubMed 25075903