Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #64103)


Item Catalog # Description Quantity Price (USD)
Plasmid 64103 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 23453
  • Vector type
    Mammalian Expression, Mouse Targeting ; Tet Inducible
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Entrez Gene
    Gt(ROSA)26Sor (a.k.a. AV258896, Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
  • Promoter ROSA26 endogenous

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCCAGGGTTTCCTTGATGAT
  • 3′ sequencing primer GTGAAAGTGGGTCCGCGTAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The pGATOR_DTA plasmid was generated John McCafferty’s lab at the University of Cambridge in collaboration with by Bill Skarnes’ lab (Sanger). Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. ( Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGATOR-DTA was a gift from Bill Skarnes (Addgene plasmid # 64103 ; ; RRID:Addgene_64103)
  • For your References section:

    Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells. Melidoni AN, Dyson MR, Wormald S, McCafferty J. Proc Natl Acad Sci U S A. 2013 Oct 29;110(44):17802-7. doi: 10.1073/pnas.1312062110. Epub 2013 Sep 30. 10.1073/pnas.1312062110 PubMed 24082130