Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHAGE-TO-dCas9-GFP
(Plasmid #64106)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64106 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 11546
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sp dCas9
  • Species
    Synthetic
  • Insert Size (bp)
    4101
  • Promoter CMV-TO
  • Tag / Fusion Protein
    • sfGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgaaggaatagaagaagaaggtgga
  • 3′ sequencing primer CCAAAGGGAGATCCGACTCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-TO-dCas9-GFP was a gift from Thoru Pederson (Addgene plasmid # 64106 ; http://n2t.net/addgene:64106 ; RRID:Addgene_64106)
  • For your References section:

    Multicolor CRISPR labeling of chromosomal loci in human cells. Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):3002-7. doi: 10.1073/pnas.1420024112. Epub 2015 Feb 23. 10.1073/pnas.1420024112 PubMed 25713381