-
PurposeBicaudal D protein aa1-594 (excluding start Met) with N-terminal tandem dimer Tomato and flag tags and C-terminal FKBP
-
Depositing Labs
-
Depositing OrganizationOregon Health & Science University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBa-tdTomato-FKBP
- Backbone size w/o insert (bp) 7752
- Total vector size (bp) 9582
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBicaudal D protein
-
Alt nameBicD2
-
Alt nameflag-BicD2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1830
-
Mutationno start methionine, aa1-594
-
GenBank IDAJ250106
-
Entrez GeneBicd2
- Promoter chicken Beta Actin
-
Tags
/ Fusion Proteins
- tdTomato (N terminal on backbone)
- flag (N terminal on insert)
- FKBP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site RsrII (not destroyed)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer GATGAGTTTGGACAAACCAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bybicaudal D2 mouse from ATCC
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa-tdTomato-flag-BicD2 594-FKBP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 64205 ; http://n2t.net/addgene:64205 ; RRID:Addgene_64205) -
For your References section:
A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations. Bentley M, Decker H, Luisi J, Banker G. J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26. 10.1083/jcb.201408056 PubMed 25624392