Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #64250)


Item Catalog # Description Quantity Price (USD)
Plasmid 64250 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Adam Bogdanove, Daniel Voytas lab
  • Backbone size w/o insert (bp) 2568
  • Total vector size (bp) 2986
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    U6a:sgRNA (tyr)
  • gRNA/shRNA sequence
  • Species
    D. rerio (zebrafish)
  • GenBank ID
    NC_007126.6 NC_007126.6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 3′ sequencing primer CTCGGTGCCACTTTTTCAAGTTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6a:sgRNA(tyr) was a gift from Wenbiao Chen (Addgene plasmid # 64250 ; ; RRID:Addgene_64250)
  • For your References section:

    Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Yin L, Maddison LA, Li M, Kara N, LaFave MC, Varshney GK, Burgess SM, Patton JG, Chen W. Genetics. 2015 Apr 8. pii: genetics.115.176917. 10.1534/genetics.115.176917 PubMed 25855067