-
Purposeexpresses sgRNA(tyr) under U6a promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLR-NN
-
Backbone manufacturerAdam Bogdanove, Daniel Voytas lab
- Backbone size w/o insert (bp) 2568
- Total vector size (bp) 2986
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6a:sgRNA (tyr)
-
gRNA/shRNA sequencegGACTGGAGGACTTCTGGGG
-
SpeciesD. rerio (zebrafish)
-
GenBank IDNC_007126.6 NC_007126.6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TTGGGCCCGGTCTCTAGTCAAGTCTCTCAGCGTTTCTCC
- 3′ sequencing primer CTCGGTGCCACTTTTTCAAGTTG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6a:sgRNA(tyr) was a gift from Wenbiao Chen (Addgene plasmid # 64250 ; http://n2t.net/addgene:64250 ; RRID:Addgene_64250) -
For your References section:
Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Yin L, Maddison LA, Li M, Kara N, LaFave MC, Varshney GK, Burgess SM, Patton JG, Chen W. Genetics. 2015 Apr 8. pii: genetics.115.176917. 10.1534/genetics.115.176917 PubMed 25855067