Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCDH-EF1-FHC
(Plasmid #64874)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64874 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Cloning Grade DNA 64874-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $95

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDH-CMV-MCS-EF1-Puro
  • Backbone manufacturer
    System Biosciences
  • Modifications to backbone
    Addition of FLAG and HA tags
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin
  • Tags / Fusion Proteins
    • Flag (C terminal on backbone)
    • HA (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer EF1a-F_alt (gccgtgaacgttctttttc)
  • 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Information for Cloning Grade DNA (Catalog # 64874-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $95 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EF1-FHC was a gift from Richard Wood (Addgene plasmid # 64874 ; http://n2t.net/addgene:64874 ; RRID:Addgene_64874)
  • For your References section:

    Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PGENETICS-D-14-01461 [pii] PubMed 25275444