Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

ins:CFP-NTR
(Plasmid #66593)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66593 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    I-Sce I element containing vector
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Insulin promotor driving CFP-nitroreductase
  • Alt name
    ins:CFP-Eco.NfsB
  • Species
    D. rerio (zebrafish); Aequorea victoria, E.coli
  • Insert Size (bp)
    3000
  • Promoter Zebrafish Insulin promoter (approximately 1.2kb)
  • Tag / Fusion Protein
    • CFP fused with N-terminus of nitroreductase (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCTATTCGTCCCAAAACATCTCCAC
  • 3′ sequencing primer TAGCATCACAAATTTCACAAATAAAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ins:CFP-NTR was a gift from Didier Stainier (Addgene plasmid # 66593 ; http://n2t.net/addgene:66593 ; RRID:Addgene_66593)
  • For your References section:

    Conditional targeted cell ablation in zebrafish: a new tool for regeneration studies. Curado S, Anderson RM, Jungblut B, Mumm J, Schroeter E, Stainier DY. Dev Dyn. 2007 Apr . 236(4):1025-35. 10.1002/dvdy.21100 PubMed 17326133