Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-Ef1a-DIO-OMOR-eYFP
(Plasmid #66847)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66847 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 6330
  • Total vector size (bp) 7448
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Opto Mu opioid receptor
  • Alt name
    OMOR
  • Alt name
    Opto-MOR
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1118
  • Promoter Ef1a
  • Tag / Fusion Protein
    • eYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer gcttatcgataatcaacctctgg
  • 3′ sequencing primer GGT GAA CAG CTC CTC GCC CTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO-OMOR-eYFP was a gift from Michael Bruchas (Addgene plasmid # 66847 ; http://n2t.net/addgene:66847 ; RRID:Addgene_66847)
  • For your References section:

    Spatiotemporal control of opioid signaling and behavior. Siuda ER, Copits BA, Schmidt MJ, Baird MA, Al-Hasani R, Planer WJ, Funderburk SC, McCall JG, Gereau RW 4th, Bruchas MR. Neuron. 2015 May 20;86(4):923-35. doi: 10.1016/j.neuron.2015.03.066. Epub 2015 Apr 30. 10.1016/j.neuron.2015.03.066 PubMed 25937173