Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-sgLkb1/Cre
(Plasmid #66894)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.3
  • Total vector size (bp) 7761
  • Vector type
    Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgLkb1
  • gRNA/shRNA sequence
    GTGGTGGGCCGCAGTCACAA
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgLkb1/Cre was a gift from Monte Winslow (Addgene plasmid # 66894 ; http://n2t.net/addgene:66894 ; RRID:Addgene_66894)
  • For your References section:

    Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Chiou SH, Winters IP, Wang J, Naranjo S, Dudgeon C, Tamburini FB, Brady JJ, Yang D, Gruner BM, Chuang CH, Caswell DR, Zeng H, Chu P, Kim GE, Carpizo DR, Kim SK, Winslow MM. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15. 10.1101/gad.264861.115 PubMed 26178787