Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68256)


Item Catalog # Description Quantity Price (USD)
Plasmid 68256 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    pICH47761 (AddGene #48003)
  • Total vector size (bp) 4718
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Can also be grown in Agrobacterium tumefaciens GV3101/ LBA4404. Will be low copy in this species.
  • Copy number
    High Copy


  • Gene/Insert name
    Promoter_AtU6-26 + sgRNA_BolC.GA4a-2
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    A portion of this gene came from AddGene #46966. A gift from Sophien Kamoun.
  • Terms and Licenses

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pICSL11062 was a gift from Nicola Patron (Addgene plasmid # 68256 ; ; RRID:Addgene_68256)
  • For your References section:

    Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Lawrenson T, Shorinola O, Stacey N, Li C, Ostergaard L, Patron N, Uauy C, Harwood W. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. 10.1186/s13059-015-0826-7 [pii] PubMed 26616834