pICSL11062
(Plasmid
#68256)
-
PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-2 in Brassica oleracea
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 68256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH47761 (AddGene #48003)
- Total vector size (bp) 4718
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsCan also be grown in Agrobacterium tumefaciens GV3101/ LBA4404. Will be low copy in this species.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePromoter_AtU6-26 + sgRNA_BolC.GA4a-2
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)350
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
- 3′ sequencing primer CTGGTGGCAGGATATATTGTGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byA portion of this gene came from AddGene #46966. A gift from Sophien Kamoun.
-
Terms and Licenses
Depositor Comments
Target sequence: GTTGAGAGGGGAGCCGGTGA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL11062 was a gift from Nicola Patron (Addgene plasmid # 68256 ; http://n2t.net/addgene:68256 ; RRID:Addgene_68256) -
For your References section:
Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Lawrenson T, Shorinola O, Stacey N, Li C, Ostergaard L, Patron N, Uauy C, Harwood W. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. 10.1186/s13059-015-0826-7 [pii] PubMed 26616834