pTXB3 AurA
(Plasmid
#68270)
-
Purposebacterial expression of human AurA
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6700
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAurA
-
Alt nameaurora kinase A
-
Alt nameAURKA
-
Alt nameARK1
-
SpeciesH. sapiens (human)
-
MutationSee depositor comment below
-
Entrez GeneAURKA (a.k.a. AIK, ARK1, AURA, BTAK, PPP1R47, STK15, STK6, STK7)
- Promoter T7
-
Tag
/ Fusion Protein
- Mxe intein/chitin binding domain (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7
- 3′ sequencing primer MxeInt-R AGGGCAACTAGTGCATCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use BL21 cells for protein production.
AurA mutation V57I has been described as “common coding region polymorphism” (Egan K et al., 2004, Carcinogenesis 25:2149)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXB3 AurA was a gift from Stefano Ferrari (Addgene plasmid # 68270 ; http://n2t.net/addgene:68270 ; RRID:Addgene_68270) -
For your References section:
Inhibition of Aurora A in response to DNA damage. Krystyniak A, Garcia-Echeverria C, Prigent C, Ferrari S. Oncogene. 2006 Jan 19;25(3):338-48. 10.1038/sj.onc.1209056 PubMed 16158051