Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68720)


Item Catalog # Description Quantity Price (USD)
Plasmid 68720 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 68720-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Due to ease of recombination, AAV and lentivirus vectors should be amplified in a recombination deficient bacteria strain such as Invitrogen's OneShot Stbl3 cells. Check for integrety of ITR sites with SmaI digest.
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
  • Mutation
    Cre-dependent expression from inverted open reading frame (i.e. 'FLEXED')
  • Promoter hSyn1-FLEX

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer actcagcgctgcctcagtct
  • 3′ sequencing primer gtttgtacaaatgatgacagcgaag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed)
Addgene Plasmid 40260

Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed)
Addgene Plasmid 40753

Information for AAV1 (Catalog # 68720-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (#68720). In addition to the viral particles, you will also receive purified pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA plasmid DNA.

Cre-dependent GCaMP6s calcium sensor and bicistronic, physically separate mRuby2 expression under a human synapsin1 promoter. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mRuby2 (Cre-dependent)


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA was a gift from Tobias Bonhoeffer & Mark Huebener & Tobias Rose (Addgene plasmid # 68720 ; ; RRID:Addgene_68720)

    For viral preps, please replace (Addgene plasmid # 68720) in the above sentence with: (Addgene viral prep # 68720-AAV1)

  • For your References section:

    Cell-specific restoration of stimulus preference after monocular deprivation in the visual cortex. Rose T, Jaepel J, Hubener M, Bonhoeffer T. Science. 2016 Jun 10;352(6291):1319-22. doi: 10.1126/science.aad3358. 10.1126/science.aad3358 PubMed 27284193