This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
(Plasmid #70659)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 70659 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
  • gRNA/shRNA sequence
    GGATGACAGATGATGGATGG

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR - Amplicon, BCR/ABL sgRNA 1 was a gift from David Sabatini (Addgene plasmid # 70659 ; http://n2t.net/addgene:70659 ; RRID:Addgene_70659)
  • For your References section:

    Identification and characterization of essential genes in the human genome. Wang T, Birsoy K, Hughes NW, Krupczak KM, Post Y, Wei JJ, Lander ES, Sabatini DM. Science. 2015 Oct 15. pii: aac7041. 10.1126/science.aac7041 PubMed 26472758