Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
(Plasmid #71707)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 71707 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Zhang lab, Addgene plasmid 42230
  • Total vector size (bp) 8854
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9 fused to human Geminin
  • Alt name
    hSpCas9-hGem(1/110)
  • Alt name
    hCas9-hGem(1/110)
  • Alt name
    GEMININ
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4614
  • Entrez Gene
    GMNN (a.k.a. Gem, MGORS6)
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • hGEM(1/110) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCBhProF (AGGGATGGTTGGTTGGTGGG)
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT or BGH-rev
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) was a gift from Giulio Draetta (Addgene plasmid # 71707 ; http://n2t.net/addgene:71707 ; RRID:Addgene_71707)
  • For your References section:

    Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Gutschner T, Haemmerle M, Genovese G, Draetta GF, Chin L. Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019. 10.1016/j.celrep.2016.01.019 PubMed 26854237