pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
(Plasmid #71707)

• Purpose: A human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmid
• Depositing Lab: Giulio Draetta
• Publication: Gutschner et al Cell Rep. 2016 Feb 3. pii: S2211-1247(16)00040-1. doi: 10.1016/j.celrep.2016.01.019.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Backbone manufacturer: Zhang lab, Addgene plasmid 42230
• Total vector size (bp): 8854
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9 fused to human Geminin
• Alt name: hSpCas9-hGem(1/110)
• Alt name: hCas9-hGem(1/110)
• Alt name: GEMININ
• Species: H. sapiens (human)
• Insert Size (bp): 4614
• Entrez Gene: GMNN (a.k.a. Gem, MGORS6)
• Promoter: CBh
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert)
  • hGEM(1/110) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pCBhProF (AGGGATGGTTGGTTGGTGGG)
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT or BGH-rev

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry