pX330(puro) Rosa26-H3F3B
(Plasmid
#73131)
-
PurposeExpression in Mammalian Cells, Cas9 Nuclease to analize translocations
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX330
- Total vector size (bp) 10709
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
gRNA/shRNA sequencemouse Rosa26 and H3F3B
-
SpeciesM. musculus (mouse)
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gacgtcaatgggcgggggtcgttggg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene Plasmid #42230)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We cloned 2 guide RNAs and a puromycin cassette.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330(puro) Rosa26-H3F3B was a gift from Agnel Sfeir (Addgene plasmid # 73131 ; http://n2t.net/addgene:73131 ; RRID:Addgene_73131) -
For your References section:
Mammalian polymerase theta promotes alternative NHEJ and suppresses recombination. Mateos-Gomez PA, Gong F, Nair N, Miller KM, Lazzerini-Denchi E, Sfeir A. Nature. 2015 Feb 12;518(7538):254-7. doi: 10.1038/nature14157. Epub 2015 Feb 2. 10.1038/nature14157 PubMed 25642960