Skip to main content

lenti sgRNA(MS2)_puro backbone
(Plasmid #73795)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73795 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Cloning Grade DNA 73795-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $115

Backbone

  • Vector backbone
    plenti
  • Backbone size (bp) 10221
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6 and EF1A
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
  • 3′ sequencing primer cctagaaggtccattagctgcaaagattcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $115 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti sgRNA(MS2)_puro backbone was a gift from Feng Zhang (Addgene plasmid # 73795 ; http://n2t.net/addgene:73795 ; RRID:Addgene_73795)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202