pMIG-hH4-AVITEV
(Plasmid #74051)

• Purpose: retroviral expression plasmid for human histone H4 with C-terminal BirA-biotinylation signal and TEV celavage site
• Depositing Lab: Ria Baumgrass
• Publication: Gabriel et al J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.

Backbone

• Vector backbone: pMSCV-IRES-GFP (pMIG)
• Backbone size w/o insert (bp): 7200
• Total vector size (bp): 7505
• Modifications to backbone: SV40 ori added
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human Histone-H4
• Species: H. sapiens (human)
• Insert Size (bp): 300
• GenBank ID: NM_003540.3
• Entrez Gene: H4C16 (a.k.a. H4-16, H4/p, H4C1, H4C11, H4C12, H4C13, H4C14, H4C15, H4C2, H4C3, H4C4, H4C5, H4C6, H4C8, H4C9, HIST4H4)
• Promoter: pMSCV-LTRs
• Tag / Fusion Protein:
  • AVI-TEV (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (not destroyed)
• 3′ cloning site: SnaB1, Sgf1 (not destroyed)
• 5′ sequencing primer: CGTTCGACCCCGCCTCGATCC
• 3′ sequencing primer: AGCTTGATATCGAATTCCG

Resource Information

• Supplemental Documents:
  • AVITEV-vector cloning site
• A portion of this plasmid was derived from a plasmid made by: synthesis by company

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note- there are several nucleotide mismatches when compared to NM_003540.3. This construct was codon-optomized to allow for high expression rates.

The Avi-Tev-Tag is biotinylated by BirA E.coli biotin ligase when coexpressed, and can be cleaved by TEV protease.