Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

5UAS zfSynaptophysin:GFP
(Plasmid #74316)


Item Catalog # Description Quantity Price (USD)
Plasmid 74316 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
  • Mutation
    Q12H and deletion of F13 (please see depositor comment below)
  • Promoter 5UAS
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Ecor1 (not destroyed)
  • 3′ cloning site Sma1 (not destroyed)
  • 5′ sequencing primer ATGGATGTTGCCAACCAGTT
  • 3′ sequencing primer TGGACGAGCTGTACAAGTAA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The depositor noted that the Q12H mutation and deletion of F13 found in Addgene's quality control sequence does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5UAS zfSynaptophysin:GFP was a gift from Martin Meyer & Stephen Smith (Addgene plasmid # 74316 ; ; RRID:Addgene_74316)
  • For your References section:

    Evidence from in vivo imaging that synaptogenesis guides the growth and branching of axonal arbors by two distinct mechanisms. Meyer MP, Smith SJ. J Neurosci. 2006 Mar 29;26(13):3604-14. 10.1523/JNEUROSCI.0223-06.2006 PubMed 16571769