Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

5UAS zfSynaptophysin:GFP-5UAS DsRedExpress
(Plasmid #74317)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74317 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    synaptophysin
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    960
  • Promoter 5UAS
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ATGGATGTTGCCAACCAGTT
  • 3′ sequencing primer TGGACGAGCTGTACAAGTAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DsRedExpress
  • Insert Size (bp)
    700
  • Promoter 5UAS

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer ATGGCCTCCTCCGAGGACGT
  • 3′ sequencing primer CACCACCTGTTCCTGTAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    5UAS zfSynaptophysin:GFP-5UAS DsRedExpress was a gift from Martin Meyer & Stephen Smith (Addgene plasmid # 74317 ; http://n2t.net/addgene:74317 ; RRID:Addgene_74317)
  • For your References section:

    Evidence from in vivo imaging that synaptogenesis guides the growth and branching of axonal arbors by two distinct mechanisms. Meyer MP, Smith SJ. J Neurosci. 2006 Mar 29;26(13):3604-14. 10.1523/JNEUROSCI.0223-06.2006 PubMed 16571769