Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #74314)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 74314 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5
  • Total vector size (bp) 7
  • Modifications to backbone
    CMV promoter removed and replaced with 14 UAS repeats

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    zebrafish PSD95
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
  • Mutation
    Y599H and I793S (please see depositor comment below)
  • Promoter UAS
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site Sma1 (not destroyed)
  • 5′ sequencing primer ATGCCTCTCAAACGAGAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The depositor noted that the Y599H and I793S mutations found in Addgene's quality control sequence does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    14UAS zfPSD95:GFP was a gift from Martin Meyer & Stephen Smith (Addgene plasmid # 74314 ; ; RRID:Addgene_74314)
  • For your References section:

    In vivo imaging of synapse formation on a growing dendritic arbor. Niell CM, Meyer MP, Smith SJ. Nat Neurosci. 2004 Mar;7(3):254-60. Epub 2004 Feb 1. 10.1038/nn1191 PubMed 14758365