Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

gWizPlum
(Plasmid #74475)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74475 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    gWiz-blank
  • Backbone manufacturer
    Aldevron
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 5800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mPlum fluorescent protein
  • Insert Size (bp)
    718
  • Promoter CMV+intron

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pMRB101-F - aagatgcaggcagctgagtt
  • 3′ sequencing primer pXCX-F - ACAACAGATGGCTGGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A portion of this plasmid was derived from the pmPlum Vector, C/N 632537, Clontech.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plum is a far red fluorescent protein.
Excitation 590 nm
Emission 649 nm

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gWizPlum was a gift from Loree Heller (Addgene plasmid # 74475 ; http://n2t.net/addgene:74475 ; RRID:Addgene_74475)