-
PurposeFor cloning and constitutive expression of sgRNAs in E.coli. New sgRNAs are cloned into SapI sites and multiplex sgRNAs are cloned into BsaI sites. Kanamycin resistant with pSC101 origin of rep.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB4K5
-
Backbone manufacturerRegistry of Standard Biological Parts (http://parts.igem.org/Part:pSB4K5)
-
Modifications to backbonesgRNA added
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
Alt namegRNA
-
gRNA/shRNA sequenceAGAAGAGCGACAGGCTCTTCT
-
SpeciesSynthetic
- Promoter J23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer AATACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG4K5 was a gift from Xiao Wang (Addgene plasmid # 74492 ; http://n2t.net/addgene:74492 ; RRID:Addgene_74492) -
For your References section:
Targeted Large-Scale Deletion of Bacterial Genomes Using CRISPR-Nickases. Standage-Beier K, Zhang Q, Wang X. ACS Synth Biol. 2015 Nov 20;4(11):1217-25. doi: 10.1021/acssynbio.5b00132. Epub 2015 Oct 25. 10.1021/acssynbio.5b00132 PubMed 26451892