Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSG4K5
(Plasmid #74492)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 74492 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB4K5
  • Backbone manufacturer
    Registry of Standard Biological Parts (http://parts.igem.org/Part:pSB4K5)
  • Modifications to backbone
    sgRNA added
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sgRNA
  • Alt name
    gRNA
  • gRNA/shRNA sequence
    AGAAGAGCGACAGGCTCTTCT
  • Species
    Synthetic
  • Promoter J23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer AATACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSG4K5 was a gift from Xiao Wang (Addgene plasmid # 74492 ; http://n2t.net/addgene:74492 ; RRID:Addgene_74492)
  • For your References section:

    Targeted Large-Scale Deletion of Bacterial Genomes Using CRISPR-Nickases. Standage-Beier K, Zhang Q, Wang X. ACS Synth Biol. 2015 Nov 20;4(11):1217-25. doi: 10.1021/acssynbio.5b00132. Epub 2015 Oct 25. 10.1021/acssynbio.5b00132 PubMed 26451892