-
PurposeFlp-dependent Chr2-mCherry encoded in an AAV vector for rAAV production and expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 75470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CAG-FRTed-SynGFPreverse-WPRE
- Backbone size w/o insert (bp) 5667
- Total vector size (bp) 7413
-
Vector typeMammalian Expression, AAV, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameReversed ChR2(H134R)-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)1647
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTCTGCTAACCATGTTCATGC
- 3′ sequencing primer GCCATACGGGAAGCAATAGC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Article Citing this Plasmid
Depositor Comments
Please cite:
Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL (2016) Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Elife 5. doi:10.7554/eLife.15312
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry was a gift from Connie Cepko (Addgene plasmid # 75470 ; http://n2t.net/addgene:75470 ; RRID:Addgene_75470) -
For your References section:
Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL. Elife. 2016 May 20;5. pii: e15312. doi: 10.7554/eLife.15312. 10.7554/eLife.15312 PubMed 27205882