This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy in light of the new GDPR standards. When logging in or creating a new account, you will be asked to read and acknowledge these policy changes. Additionally, you can find our Transparency and Privacy Policy here.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #75470)


Item Catalog # Description Quantity Price (USD)
Plasmid 75470 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5667
  • Total vector size (bp) 7413
  • Vector type
    Mammalian Expression, AAV, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    Reversed ChR2(H134R)-mCherry
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GCCATACGGGAAGCAATAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please cite:

Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL (2016) Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Elife 5. doi:10.7554/eLife.15312

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry was a gift from Connie Cepko (Addgene plasmid # 75470)
  • For your References section:

    Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL. Elife. 2016 May 20;5. pii: e15312. doi: 10.7554/eLife.15312. 10.7554/eLife.15312 PubMed 27205882