Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #75470)


Item Catalog # Description Quantity Price (USD)
Plasmid 75470 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 75470-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5667
  • Total vector size (bp) 7413
  • Vector type
    Mammalian Expression, AAV, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    Reversed ChR2(H134R)-mCherry
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GCCATACGGGAAGCAATAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please cite:

Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL (2016) Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Elife 5. doi:10.7554/eLife.15312

Information for AAV1 (Catalog # 75470-AAV1) ( Back to top )


Ready-to-use AAV1 particles produced from pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (#75470). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry plasmid DNA.

CAG-driven, Flp recombinase-dependent expression of channelrhodopsin H134R mutant fused to mCherry. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using recombinase-dependent vectors in vivo: FRT sites in fDIO plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Flp-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Flp-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Flp-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Flp-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry was a gift from Connie Cepko (Addgene plasmid # 75470 ; ; RRID:Addgene_75470)

    For viral preps, please replace (Addgene plasmid # 75470) in the above sentence with: (Addgene viral prep # 75470-AAV1)

  • For your References section:

    Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL. Elife. 2016 May 20;5. pii: e15312. doi: 10.7554/eLife.15312. 10.7554/eLife.15312 PubMed 27205882