Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFUChW nontargeting shRNA
(Plasmid #78522)


Item Catalog # Description Quantity Price (USD)
Plasmid 78522 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10069
  • Total vector size (bp) 10129
  • Modifications to backbone
    EGFP reporter in pFUGW replaced with mCherry
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • gRNA/shRNA sequence
    Non-targeting shRNA
  • Species
    M. musculus (mouse)
  • Promoter UbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer TGTAATCATTTGGGTCAATATGTAA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUChW nontargeting shRNA was a gift from David Chan (Addgene plasmid # 78522 ; ; RRID:Addgene_78522)
  • For your References section:

    Elimination of paternal mitochondria in mouse embryos occurs through autophagic degradation dependent on PARKIN and MUL1. Rojansky R, Cha MY, Chan DC. Elife. 2016 Nov 17;5. pii: e17896. doi: 10.7554/eLife.17896. 10.7554/eLife.17896 PubMed 27852436