This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #78897)


Item Catalog # Description Quantity Price (USD)
Plasmid 78897 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Perrimon Lab
  • Backbone size w/o insert (bp) 9690
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter 10XUAS
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAACATCCCATATTCAGCCGC
  • 3′ sequencing primer TTTGTCCAATTATGTCACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9-VPR insert cloned from PMID 25730490 into pWalium20 for in vivo Drosophila expression
  • Terms and Licenses
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWalium20-10XUAS-3XFLAG-dCas9-VPR was a gift from Norbert Perrimon (Addgene plasmid # 78897 ; ; RRID:Addgene_78897)
  • For your References section:

    In Vivo Transcriptional Activation Using CRISPR/Cas9 in Drosophila. Lin S, Ewen-Campen B, Ni X, Housden BE, Perrimon N. Genetics. 2015 Oct;201(2):433-42. doi: 10.1534/genetics.115.181065. Epub 2015 Aug 5. 10.1534/genetics.115.181065 PubMed 26245833