Cas9-GFP_sg_mTfeb
(Plasmid
#79006)
-
PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 79006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
- Total vector size (bp) 9300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgTfeb
-
gRNA/shRNA sequenceAGCACTGTTGCCGGCCGAGG
-
SpeciesM. musculus (mouse)
-
Entrez GeneTfeb (a.k.a. Tcfeb, bHLHe3, bHLHe35)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9-GFP_sg_mTfeb was a gift from Reuben Shaw (Addgene plasmid # 79006 ; http://n2t.net/addgene:79006 ; RRID:Addgene_79006) -
For your References section:
AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Young NP, Kamireddy A, Van Nostrand JL, Eichner LJ, Shokhirev MN, Dayn Y, Shaw RJ. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. 10.1101/gad.274142.115 PubMed 26944679