pAAV-Ef1a-DIO_EGFP-GFE3
(Plasmid
#79871)
-
PurposeFor generating adeno-associated virus to express GFE3 under the EF1a promoter in a 'Cre-on' dependent manner.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 79871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 5607
- Total vector size (bp) 6916
-
Vector typeMammalian Expression, AAV, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-GFE3
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)1305
- Promoter EF1a
-
Tags
/ Fusion Proteins
- GFP (N terminal on insert)
- HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO_EGFP-GFE3 was a gift from Don Arnold (Addgene plasmid # 79871 ; http://n2t.net/addgene:79871 ; RRID:Addgene_79871) -
For your References section:
An E3-ligase-based method for ablating inhibitory synapses. Gross GG, Straub C, Perez-Sanchez J, Dempsey WP, Junge JA, Roberts RW, Trinh LA, Fraser SE, De Koninck Y, De Koninck P, Sabatini BL, Arnold DB. Nat Methods. 2016 Jun 6. doi: 10.1038/nmeth.3894. 10.1038/nmeth.3894 PubMed 27271196