Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-Ef1a-DIO_EGFP-GFE3
(Plasmid #79871)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79871 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 5607
  • Total vector size (bp) 6916
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP-GFE3
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1305
  • Promoter EF1a
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO_EGFP-GFE3 was a gift from Don Arnold (Addgene plasmid # 79871 ; http://n2t.net/addgene:79871 ; RRID:Addgene_79871)
  • For your References section:

    An E3-ligase-based method for ablating inhibitory synapses. Gross GG, Straub C, Perez-Sanchez J, Dempsey WP, Junge JA, Roberts RW, Trinh LA, Fraser SE, De Koninck Y, De Koninck P, Sabatini BL, Arnold DB. Nat Methods. 2016 Jun 6. doi: 10.1038/nmeth.3894. 10.1038/nmeth.3894 PubMed 27271196