-
PurposeIntracellular Ca2+ store marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4725
- Total vector size (bp) 6981
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTPCN2
-
Alt nameTPC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2256
-
Entrez GeneTPCN2 (a.k.a. SHEP10, TPC2)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N3-TPC2 was a gift from Santiago Di Pietro (Addgene plasmid # 80153 ; http://n2t.net/addgene:80153 ; RRID:Addgene_80153) -
For your References section:
TPC2 mediates new mechanisms of platelet dense granule membrane dynamics through regulation of Ca2+ release. Ambrosio AL, Boyle JA, Di Pietro SM. Mol Biol Cell. 2015 Sep 15;26(18):3263-74. doi: 10.1091/mbc.E15-01-0058. Epub 2015 Jul 22. 10.1091/mbc.E15-01-0058 PubMed 26202466