Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP-N3-TPC2
(Plasmid #80153)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80153 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4725
  • Total vector size (bp) 6981
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TPCN2
  • Alt name
    TPC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2256
  • Entrez Gene
    TPCN2 (a.k.a. SHEP10, TPC2)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N3-TPC2 was a gift from Santiago Di Pietro (Addgene plasmid # 80153 ; http://n2t.net/addgene:80153 ; RRID:Addgene_80153)
  • For your References section:

    TPC2 mediates new mechanisms of platelet dense granule membrane dynamics through regulation of Ca2+ release. Ambrosio AL, Boyle JA, Di Pietro SM. Mol Biol Cell. 2015 Sep 15;26(18):3263-74. doi: 10.1091/mbc.E15-01-0058. Epub 2015 Jul 22. 10.1091/mbc.E15-01-0058 PubMed 26202466