pSicoR-shS6K1/2
(Plasmid
#81088)
-
Purposeexpresses an shRNA targeting both S6K1 and S6K2 (mouse)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81088 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSicoR
-
Backbone manufacturerJacks Lab (MIT)
- Backbone size w/o insert (bp) 7567
- Total vector size (bp) 7609
-
Vector typeMammalian Expression, Lentiviral, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS6K1 & S6K2 shRNA
-
gRNA/shRNA sequenceCTCAGTGAGAGTGCCAACCAA
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer mU6-F (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypSicoR was obtained from Addgene (plasmid 11579). shRNA insert was synthesized independently but is based on a target sequence from Bae et al. 2012 (PMID: 22493495)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pSicoR allows for expression of the S6K1/2 shRNA in the absence of Cre. Expression of Cre turns off shRNA expression. These plasmids were also used in the following publication "Normalizing translation through 4E-BP prevents mTOR-driven cortical mislamination and ameliorates aberrant neuron integration. Lin TV, Hsieh L, Kimura T, Malone TJ, Bordey A. Proc Natl Acad Sci U S A. 2016 Oct 4;113(40):11330-11335."
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSicoR-shS6K1/2 was a gift from Angelique Bordey (Addgene plasmid # 81088 ; http://n2t.net/addgene:81088 ; RRID:Addgene_81088) -
For your References section:
mTORC1 targets the translational repressor 4E-BP2, but not S6 kinase 1/2, to regulate neural stem cell self-renewal in vivo. Hartman NW, Lin TV, Zhang L, Paquelet GE, Feliciano DM, Bordey A. Cell Rep. 2013 Oct 31;5(2):433-44. doi: 10.1016/j.celrep.2013.09.017. Epub 2013 Oct 17. 10.1016/j.celrep.2013.09.017 PubMed 24139800