-
PurposeWT1 targeting donor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneOCT4-2A-eGFP
-
Backbone manufacturerAddgene #31939
- Backbone size w/o insert (bp) 6804
- Total vector size (bp) 10650
-
Modifications to backboneReplacing OCT4 5' and 3' arms with WT1 arms
-
Vector typeMammalian Expression, CRISPR, TALEN
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameWT1 5' Arm
-
Alt nameWilms tumor 1
-
Alt nameAWT1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1990
-
GenBank IDGene ID 7490
-
Entrez GeneWT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
-
Tag
/ Fusion Protein
- 2A-eGFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGAC
- 3′ sequencing primer CCGGGATTCTCTTCGACAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameWT1 3' Arm
-
Alt nameWilms tumor 1
-
Alt nameAWT1
-
Insert Size (bp)2046
-
Entrez GeneWT1 (a.k.a. AWT1, GUD, NPHS4, WAGR, WIT-2, WT-1, WT33)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGAGATCAGCAGCCTCTGT
- 3′ sequencing primer TGTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WT1-2A-eGFP PGK PuroR Donor Plasmid was a gift from Sean Palecek (Addgene plasmid # 82333 ; http://n2t.net/addgene:82333 ; RRID:Addgene_82333) -
For your References section:
Long-term self-renewing human epicardial cells generated from pluripotent stem cells under defined xeno-free conditions. Bao X, Lian X, Hacker TA, Schmuck EG, Qian T, Bhute VJ, Han T, Shi M, Drowley L, Plowright A, Wang QD, Goumans MJ, Palecek SP. Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5. 10.1038/s41551-016-0003 PubMed 28462012