Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #82580)


Item Catalog # Description Quantity Price (USD)
Plasmid 82580 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 3500
  • Vector type
    Mammalian Expression
  • Promoter CBh
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene #42230
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The plasmid is a modification of Addgene:
42230 - pX330-U6-Chimeric_BB-CBh-hSpCas9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Puro-ccdB was a gift from Ivo Huijbers (Addgene plasmid # 82580 ; ; RRID:Addgene_82580)
  • For your References section:

    Direct Generation of Conditional Alleles Using CRISPR/Cas9 in Mouse Zygotes. Pritchard CEJ, Kroese LJ, Huijbers IJ. Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2. 10.1007/978-1-4939-7169-5_2 PubMed 28815491