Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Sg-A
(Plasmid #83807)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83807 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MLM3636
  • Backbone size w/o insert (bp) 2278
  • Total vector size (bp) 2289
  • Modifications to backbone
    The oligos with overhang were synthesized, annealed and ligated into the sgRNA backbone linearized with BsmB1.
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SgRNA
  • gRNA/shRNA sequence
    GAGATCGAGTGCCGCATCAC(CGG)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Sg-A was a gift from Bo Feng (Addgene plasmid # 83807 ; http://n2t.net/addgene:83807 ; RRID:Addgene_83807)
  • For your References section:

    Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. He X, Tan C, Wang F, Wang Y, Zhou R, Cui D, You W, Zhao H, Ren J, Feng B. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4. 10.1093/nar/gkw064 PubMed 26850641