Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #83960)


Item Catalog # Description Quantity Price (USD)
Plasmid 83960 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Invitrogen/Dr. Paulmurugan Ramasamy
  • Backbone size w/o insert (bp) 6108
  • Total vector size (bp) 7386
  • Modifications to backbone
    In pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ASAP2f was a gift from Michael Lin (Addgene plasmid # 83960 ; ; RRID:Addgene_83960)
  • For your References section:

    Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo. Yang HH, St-Pierre F, Sun X, Ding X, Lin MZ, Clandinin TR. Cell. 2016 Jun 30;166(1):245-57. doi: 10.1016/j.cell.2016.05.031. Epub 2016 Jun 2. 10.1016/j.cell.2016.05.031 PubMed 27264607