Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84040)


Item Catalog # Description Quantity Price (USD)
Plasmid 84040 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Feng Zhang's Laboratory
  • Backbone size w/o insert (bp) 7447
  • Total vector size (bp) 8138
  • Modifications to backbone
    Insert GFP down stream of SaCas9
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • gRNA/shRNA sequence
    empty vector
  • Species
    Neisseria gonorrhoeae
  • GenBank ID
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer Cas9-HindIII 5' -S:gccccgtcgtgaagagaagcttcatcc
  • 3′ sequencing primer EGFP-EcoR1-AS:cgtagaattcggccgctttacttgtacagctcgtccatgccga
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX601-GFP was a gift from Yuet Wai Kan (Addgene plasmid # 84040 ; ; RRID:Addgene_84040)
  • For your References section:

    Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Ye L, Wang J, Tan Y, Beyer AI, Xie F, Muench MO, Kan YW. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. 10.1073/pnas.1612075113 PubMed 27601644