-
PurposeStaphylococcus aureus (SaCas9) conjugated with GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 84040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX601
-
Backbone manufacturerFeng Zhang's Laboratory
- Backbone size w/o insert (bp) 7447
- Total vector size (bp) 8138
-
Modifications to backboneInsert GFP down stream of SaCas9
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceempty vector
-
SpeciesNeisseria gonorrhoeae
-
GenBank ID7011691
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Cas9-HindIII 5' -S:gccccgtcgtgaagagaagcttcatcc
- 3′ sequencing primer EGFP-EcoR1-AS:cgtagaattcggccgctttacttgtacagctcgtccatgccga (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX601-GFP was a gift from Yuet Wai Kan (Addgene plasmid # 84040 ; http://n2t.net/addgene:84040 ; RRID:Addgene_84040) -
For your References section:
Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Ye L, Wang J, Tan Y, Beyer AI, Xie F, Muench MO, Kan YW. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. 10.1073/pnas.1612075113 PubMed 27601644