pSF4 CMV intron renilla TRICK CTE polyA
(Plasmid
#84443)
-
PurposeTRICK reporter mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSF4
-
Vector typeMammalian Expression, Luciferase ; FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRenill-TRICK
-
SpeciesSynthetic
-
Insert Size (bp)1737
- Promoter Tet-CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer Cgagacagagaagactcttgc
- 3′ sequencing primer ggttacaaataaggcaatagc (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF4 CMV intron renilla TRICK CTE polyA was a gift from Jeffrey Chao (Addgene plasmid # 84443 ; http://n2t.net/addgene:84443 ; RRID:Addgene_84443) -
For your References section:
Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328